20% OFF shipping at randomsongs.org on orders over $79 + up to 10% OFF products
randomsongs.org
home > CD37 Recombinant Protein - NCP0203 > CD37 Recombinant Protein - NCP0203
download picture
CD37 Recombinant Protein - NCP0203CD37 Recombinant Protein Catalogue Number: NCP0203 500, NCP0203 1000 Sizes: 500ug, 1mg Swiss Prot: P11049 Host: E. coli Tag: His tag AA Sequence:
Shopping security

Shopping security

Each payment you make on thelockerguy is secured with strict SSL encryption and PCI DSS data protection protocols

CD37 Recombinant Protein

Catalogue Number: NCP0203-500, NCP0203-1000

Sizes: 500ug, 1mg

Swiss-Prot: P11049

Host: E.coli

Tag: His-tag

AA Sequence: CGTGCACAGCTGGAACGCAGTCTGCGCGATGTTGTTGAAAAAACCATTCAGAAATACGGTACCAATCCGGAAGAAACCGCAGCAGAAGAAAGCTGGGATTATGTTCAGTTCCAGCTGCGTTGTTGCGGTTGGCATTATCCGCAGGATTGGTTCCAGGTTCTGATTCTGCGCGGTAATGGTAGCGAAGCACATCGTGTTCCGTGCAGTTGTTATAATCTGAGTGCCACCAATGATAGTACCATTCTGGATAAAGTGATTCTGCCGCAGCTGAGCCGTCTGGGCCATCTGGCACGTAGTCGCCATAGCGCAGATATCTGTGCAGTGCCGGCCGAAAGTCATATCTATCGCGAAGGCTGTGCACAGGGCCTGCAGAAATGGCTGCATAATAAT

Restriction Sites: NdeI-XhoI

Background: Tetra-spans transmembrane family (TSTF) members (CD9, CD37, CD53, CD63, CD81 and CD82) are cell-surface proteins that are characterized by the presence of four hydrophobic, membrane-spanning domains. TSTF members can mediate signal transduction events influencing the regulation of cell development, adhesion, activation, growth and motility. The human CD37 gene maps to chromosome 19p13.3 and encodes a 281 amino acid protein. CD37 is a cell surface glycoprotein that can complex with integrins and other TSTF proteins and may play a role in T cell-B cell interactions. CD37 is strongly expressed on normal and neoplastic mature sIg+ B cells and is detected at low levels on resting and activated T cells, neutrophils, granulocytes and monocytes. Transgenic mouse models elicit no changes in development and cellular composition of lymphoid organs where CD37 is lacking.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~16kDa

Notes: For research use only, not for use in diagnostic procedure.

CD37 Recombinant Protein - NCP0203

Item no : 61727157871
sold recently : Login >>
US$ 525.41
Pay in 4 interest-free payments of $131.35 Learn more
Min. order: 1piece

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Jun 25 - Jun 30

Enjoy 20% off shipping

US$ 525.41

1-11

US$ 472.87

12-35

US$ 367.79

36-59

US$ 315.25

60+

US$40

Get now

Sign up to your membership to get coupons up to

15%

Get now

Opportunity to enjoy order discount up to 15% off

Please add the products
Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

recommand products

Related Searches