20% OFF shipping at randomsongs.org on orders over $79 + up to 10% OFF products
randomsongs.org
home > CD172a Recombinant Protein - NCP0294 > CD172a Recombinant Protein - NCP0294
download picture
CD172a Recombinant Protein - NCP0294CD172a Recombinant Protein Catalogue Number: NCP0294 500, NCP0294 1000 Sizes: 500ug, 1mg Swiss Prot: P78324 Host: E. coli Tag: His tag AA Sequence:
Shopping security

Shopping security

Each payment you make on thelockerguy is secured with strict SSL encryption and PCI DSS data protection protocols

CD172a Recombinant Protein

Catalogue Number: NCP0294-500, NCP0294-1000

Sizes: 500ug, 1mg

Swiss-Prot: P78324

Host: E.coli

Tag: His-tag

AA Sequence: GAAGAAGAACTGCAGGTGATTCAGCCGGATAAAAGCGTTCTGGTTGCAGCAGGTGAAACCGCAACCCTGCGCTGTACCGCCACCAGCCTGATTCCGGTTGGTCCGATTCAGTGGTTCCGCGGCGCAGGTCCGGGCAGAGAACTGATCTATAATCAGAAAGAAGGTCACTTCCCGCGCGTTACCACCGTTAGTGATCTGACCAAACGTAATAATATGGACTTCAGTATTCGCATTGGTAATATTACCCCGGCAGATGCAGGTACCTATTATTGCGTGAAATTCCGTAAAGGTAGTCCGGATGATGTTGAATTCAAAAGCGGCGCAGGCACCGAACTGAGTGTGCGCGCCAAACCGAGTGCCCCGGTTGTTAGTGGCCCGGCAGCCCGTGCCACCCCTCAACATACCGTTAGCTTCACCTGTGAAAGCCATGGCTTCAGTCCGCGTGATATTACCCTGAAATGGTTCAAAAATGGTAATGAACTGAGCGACTTCCAGACCAATGTTGATCCGGTTGGTGAAAGTGTTAGCTATAGTATTCATAGCACCGCAAAAGTGGTTCTGACCCGCGAAGATGTTCATAGCCAGGTTATCTGTGAAGTGGCACATGTTACCCTGCAGGGTGATCCGCTGCGCGGTACCGCAAATCTGAGCGAAACCATTCGCGTTCCGCCGACCCTGGAAGTGACCCAGCAGCCGGTTCGTGCCGAAAATCAGGTTAATGTTACCTGCCAGGTTCGCAAATTCTATCCGCAGCGTCTGCAGCTGACCTGGCTGGAAAATGGTAATGTTAGTCGCACCGAAACCGCAAGTACCGTTACCGAAAATAAAGATGGTACCTATAATTGGATGAGTTGGCTGCTGGTGAATGTGAGTGCCCATCGCGATGATGTGAAACTGACCTGCCAGGTGGAACATGATGGTCAGCCGGCAGTGAGCAAAAGCCATGATCTGAAAGTTAGTGCCCATCCGAAAGAACAGGGTAGTAATACCGCCGCAGAAAATACCGGCAGCAATGAACGTAATATCTAT

Restriction Sites: NdeI-XhoI

Background: SHP-substrate 1 (SHPS1, SIRPα) is a single-pass membrane protein and member of both the immunoglobulin superfamily and the signal regulatory protein (SIRP) family. Following growth hormone stimulation or integrin binding, SHPS1 is phosphorylated at several tyrosine residues within its cytoplasmic tail. These phosphorylation events promote association between SHPS1 and multiple signaling proteins, including SHP-1, SHP-2, Grb2 and Shc via their SH2 domains. Recruitment of SHP-1 and SHP-2 results in SHPS1 dephosphorylation and suppression of tyrosine kinase signaling. The tyrosine kinase JAK2 associates with SHPS1 via its carboxy terminus and phosphorylates SHPS1 in response to extracellular stimuli. Research studies show that Src associates with and may phosphorylate SHPS1 in response to insulin. In macrophages, SHPS1 can form a complex with the Src pathway adaptor protein SKAP2, Fyn-binding protein FYB, and the tyrosine kinase PYK2. The SHPS1 extracellular domain contains at least three IgG-like domains that interact with CD47, a ubiquitously expressed, integrin-associated protein that acts as a repressive cue in both immune and neuronal cells. The interaction between CD47 and SHPS1 on opposing cells can inhibit cellular migration, promote "tethering" between macrophages and target cells during engulfment, facilitate self versus non-self recognition, and maintain immune homeostasis (12). SHPS1 plays a critical role in modulating the immune response and inflammation, and may play a role in neuronal development. The interaction between SHPS1 and CD47 may be an exploitable target in cancer therapy.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~38kDa

Notes: For research use only, not for use in diagnostic procedure.

CD172a Recombinant Protein - NCP0294

Item no : 69102961188
sold recently : Login >>
US$ 525.41
Pay in 4 interest-free payments of $131.35 Learn more
Min. order: 1piece

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Jun 25 - Jun 30

Enjoy 20% off shipping

US$ 525.41

1-11

US$ 472.87

12-35

US$ 367.79

36-59

US$ 315.25

60+

US$40

Get now

Sign up to your membership to get coupons up to

15%

Get now

Opportunity to enjoy order discount up to 15% off

Please add the products
Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

recommand products

Related Searches