20% OFF shipping at randomsongs.org on orders over $79 + up to 10% OFF products
randomsongs.org
home > CD154 Recombinant Protein - NCP0273 > CD154 Recombinant Protein - NCP0273
download picture
CD154 Recombinant Protein - NCP0273CD154 Recombinant Protein Catalogue Number: NCP0273 500, NCP0273 1000 Sizes: 500ug, 1mg Swiss Prot: P29965 Host: E. coli Tag: His tag AA Sequence:
Shopping security

Shopping security

Each payment you make on thelockerguy is secured with strict SSL encryption and PCI DSS data protection protocols

CD154 Recombinant Protein

Catalogue Number: NCP0273-500, NCP0273-1000

Sizes: 500ug, 1mg

Swiss-Prot: P29965

Host: E.coli

Tag: His-tag

AA Sequence: CATCGTCGCCTGGATAAAATTGAAGATGAACGTAATCTGCATGAAGACTTCGTGTTCATGAAAACCATTCAGCGCTGCAATACCGGTGAACGTAGTCTGAGTCTGCTGAATTGTGAAGAAATTAAAAGTCAGTTCGAGGGCTTCGTTAAAGATATTATGCTGAATAAAGAGGAGACCAAAAAAGAAAATAGCTTCGAAATGCAGAAGGGCGATCAGAATCCGCAGATTGCAGCCCATGTTATTAGTGAAGCAAGTAGTAAAACCACCAGCGTTCTGCAGTGGGCCGAAAAAGGTTATTATACCATGAGCAATAACCTGGTGACCCTGGAAAATGGCAAACAGCTGACCGTGAAACGTCAGGGCCTGTATTATATCTATGCCCAGGTTACCTTCTGCAGCAATCGCGAAGCCAGTAGCCAGGCCCCGTTCATTGCCAGTCTGTGTCTGAAAAGCCCGGGTCGCTTCGAACGTATTCTGCTGCGCGCCGCCAATACCCATAGCAGTGCAAAACCGTGTGGCCAGCAGAGCATTCATCTGGGTGGCGTGTTCGAACTGCAGCCGGGCGCAAGCGTGTTCGTTAATGTGACCGATCCGAGCCAGGTTAGCCATGGTACCGGCTTCACCAGCTTCGGTCTGCTGAAACTG

Restriction Sites: NdeI-XhoI

Background: CD40 ligand (CD40L), also known as CD154, TRAP, and gp39, is the ligand for the TNF receptor family member CD40. CD40L is expressed either as a soluble cytokine or as a homotrimeric transmembrane protein. CD40L primarily expressed on the surface of T-cells, but has also been reported in blood platelets, mast cells, basophils, NK cells, and B-cells. It plays an important role in stimulating B-cell cell proliferation and survival and promotes immunoglobulin class switching and secretion of IgE. Signals generated by CD40 vary depending on cell type and include activation of MAPK pathways as well as NF-κB. Mutations within the CD40L gene are associated with X-linked hyper-IgM syndrome characterized by high serum levels of IgM and decreased levels of other isotypes. The CD40L/CD40 pathway is an important area of interest in the study of cancer, vascular diseases, and inflammatory disorders.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~29kDa

Notes: For research use only, not for use in diagnostic procedure.

CD154 Recombinant Protein - NCP0273

Item no : 98626972945
sold recently : Login >>
US$ 525.41
Pay in 4 interest-free payments of $131.35 Learn more
Min. order: 1piece

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Jun 25 - Jun 30

Enjoy 20% off shipping

US$ 525.41

1-11

US$ 472.87

12-35

US$ 367.79

36-59

US$ 315.25

60+

US$40

Get now

Sign up to your membership to get coupons up to

15%

Get now

Opportunity to enjoy order discount up to 15% off

Please add the products
Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

recommand products

Related Searches